View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_low_66 (Length: 250)
Name: NF7750_low_66
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_low_66 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 15036785 - 15037022
Alignment:
| Q |
13 |
aatatttattatgagtgtaaactaattttacactaacatccaataaaattatactattttatcaaaaatctccacttttataactctattttaaaatcag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15036785 |
aatatttattatgagtgtaaactaattttacactaacatccaataaaattatactattttatcaaaaatctccacttttataactctattttaaaatcag |
15036884 |
T |
|
| Q |
113 |
ttatatgacatgaaaaatagagagcttatgttagatgctagtgaaaaactaatatgcacatattatgtattcttattaaagcatcaaaatgaatcaataa |
212 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15036885 |
tggtatgacatgaaaaatagagagcttatgttagatgctagtgaaagactaatatacacatattatgtattcttattaaagcatcaaaatgaatctataa |
15036984 |
T |
|
| Q |
213 |
aggctttatcaaacaaaataaagctatttagatcaaac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15036985 |
aggctttatcaaacaaaataaagctatttagatcaaac |
15037022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University