View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_low_67 (Length: 249)
Name: NF7750_low_67
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_low_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 43106232 - 43106446
Alignment:
| Q |
16 |
attatccaactgaaacatgggttcttaactttttattcatagtaaaatgtaaaatagtcttaggctacctacttgattaagctataagaaaggtgcaaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
43106232 |
attatccaactgaaacatgggttcttaacttcttattcatagtaaaatctaaaatagtcttaggctacctacttgattaagttgtaagaaaggtgcaaaa |
43106331 |
T |
|
| Q |
116 |
ttatggtcatactagtaa---------ttaagagtttcaaattgttttatggagtcagaattgtatgcaacatacaaaagagaattgtgttataaaacta |
206 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43106332 |
ttatggtcatactagtaattaagagttttaagagtttcaaattgtgttatgcagtcagaattgtatgcaacatacaaaagagaattgtgttataaaacta |
43106431 |
T |
|
| Q |
207 |
gtttatgttcccctc |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43106432 |
gtttatgttcccctc |
43106446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University