View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_low_69 (Length: 246)
Name: NF7750_low_69
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_low_69 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 9 - 228
Target Start/End: Complemental strand, 49673381 - 49673172
Alignment:
| Q |
9 |
gaagaatattaatgatttgaaaatgaaaagggggttcattgtgtattgcaaagccaagatacggaaacagtggtggaaaataagcaacaagtttcaagaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
49673381 |
gaagaatattaatgatttgaaaatgaaaagggggttcattgtgtattgcaaggccaagatacggaaacagtggtggaaaataagcaa----------gaa |
49673292 |
T |
|
| Q |
109 |
aatcccccactttataggtagagattgtaatgtgattcactaatgaaagtgtgttgtagttcactctttaacttccacaatatatccccgtattgaacca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49673291 |
aatcccccactttataggtagagattgtaatgtgattcactaatgaaagtgtgttgtacttcactctttaacttccacaatatatccccgtattgaacca |
49673192 |
T |
|
| Q |
209 |
cctaatacgcaagttgactt |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
49673191 |
cctaatacgcaagttgactt |
49673172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University