View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_low_73 (Length: 240)
Name: NF7750_low_73
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_low_73 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 15037290 - 15037076
Alignment:
| Q |
18 |
ccaaacttctctccaggtgcttaattcatgaaaagtctaattaattaattttatatatatcattgattattcaaagattaggtcaaaggaaaggaggaag |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15037290 |
ccaaacttctctccgggtgcttaattcatgaaatgtctaattgattaattttatatatatcattgattattcaaagattaggtcaaaggaaaggaggaag |
15037191 |
T |
|
| Q |
118 |
gaatatgaagaatctttcaaaaggaatggtacgaagtttttgcaaagatttgaagaagacaaacatgaaatatattttggcgcatcgcacaaatgttaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15037190 |
gaatatgaagaatctttcaaaaggaatggtacgaagtttttgcaaagatttgaagaagacaaacatgaaatatattttggcgcatcgcacaaatgttaat |
15037091 |
T |
|
| Q |
218 |
gagattcatctcact |
232 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
15037090 |
gagattcatttcact |
15037076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University