View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_low_79 (Length: 230)
Name: NF7750_low_79
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_low_79 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 43106710 - 43106929
Alignment:
| Q |
1 |
ccttaaattccaatgtgtttgaaattgtggcc-acatcaagtgcatttatatgcaatttttgacaatatctgatattgcacct-tgcacacgtaatttan |
98 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||| ||| || |||||||||||||| |
|
|
| T |
43106710 |
ccttaaattccaatgtgtttgaaat-gtggcccacatcaagtgcatttatatgcaatttt-gacaatatctgatat-gcaactatgcacacgtaattt-- |
43106804 |
T |
|
| Q |
99 |
nnnnnnnnnctttctat-ttccgattagactaacacttatattgaatgtatttttgtacaatacatttctaagaagttggttttatgatatgatatcaga |
197 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43106805 |
--tttttttctttctatcttccgattagactaacacttatattgaatgtatttttgtacaatacatttctacgaagttggttttatgatatgatatcaga |
43106902 |
T |
|
| Q |
198 |
atataagtgctatttttgccttctagg |
224 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
43106903 |
atataagtgctacttttgccttctagg |
43106929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University