View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_low_82 (Length: 227)
Name: NF7750_low_82
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_low_82 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 31644675 - 31644901
Alignment:
| Q |
1 |
caaaactaaatcaggtaatcaattcagttactgaaaagtgaaaacaccagggctaagcttcttttgaattcatgctcggtcactggtagtcgagcatctg |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
31644675 |
caaaaccaaatcaggtaatcaattcagttactgaaaagtgaaaacaccagggctaagcttcttttgaattcatgcacggtcactggtagtcaagcatctg |
31644774 |
T |
 |
| Q |
101 |
ctaatcctctctatgccgttcatcaagatattctgtcaagattttggaactgtatagaaatatatttgactagctttgataaatggaataaaagcataac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31644775 |
ctaatcctctctatgccgttcatcaagatattctgtcaagattttggaactgtctagaaatatatttgactagctttgataaacggaataaaagcataac |
31644874 |
T |
 |
| Q |
201 |
tcataatatcctggatgctagaccgcc |
227 |
Q |
| |
|
||||||||||| ||||||||||||||| |
|
|
| T |
31644875 |
tcataatatcccggatgctagaccgcc |
31644901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University