View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7750_low_87 (Length: 203)
Name: NF7750_low_87
Description: NF7750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7750_low_87 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 30274530 - 30274345
Alignment:
| Q |
1 |
agtgtcattgtcgtatctgatgttcatctctatgtgaatgtccataacaataatgattatgttagtactttactaatttaatgttggtaaattctgtcat |
100 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30274530 |
agtgtcattgtcgtatctaatgttcatgtctatgtgagtgtccataacaataatgattatgttagtactttactaatttaatgttggtaaattctgtcat |
30274431 |
T |
 |
| Q |
101 |
tattggaaaatcaggtaaatggagagatttacaaccatgaagctctcaggaaacagctgtctaatcacacattccgaaccggaagt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30274430 |
tattggaaaatcaggtaaatggagagatttacaaccatgaagctctcaggaaacagctgtctaatcacacattccgaacgggaagt |
30274345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 25967260 - 25967195
Alignment:
| Q |
111 |
tcaggtaaatggagagatttacaaccatgaagctctcaggaaacagctgtctaatcacacattccg |
176 |
Q |
| |
|
|||||| ||||||||||| ||||| ||||||| ||||||||||| || ||||||||| |||||| |
|
|
| T |
25967260 |
tcaggtgaatggagagatctacaatcatgaagacctcaggaaacaattgcctaatcacaaattccg |
25967195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University