View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7751_high_2 (Length: 237)
Name: NF7751_high_2
Description: NF7751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7751_high_2 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 237
Target Start/End: Original strand, 29060284 - 29060508
Alignment:
| Q |
14 |
caatacttgcaattaattatgtgttcatttcgtgttccttgtttggaattatttcatcaaaagtcaaaacaatgcatgccatatctagccatgttacttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29060284 |
caatacttgcaattaattatgtgttcatttcgtgttccttgtttggaattatttcatcaaaagtcaaaacaatgcatgccatatatagccatgttacttt |
29060383 |
T |
 |
| Q |
114 |
tcaaaatgtgaatttcaatccattgtattcctatttgcatttcaattcattcttagccacaaatacgtttca-ggcaattcaaatatttatgaaaattga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29060384 |
tcaaaatgtgaatttcaatccattgtatccctatttgcatttcaattcattcttagccacaaatacgtttcagggcaattcaaatatttatgaaaattga |
29060483 |
T |
 |
| Q |
213 |
aattcaaggtaatggcagggaaaac |
237 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
29060484 |
aattcaaggtaatggcagggaaaac |
29060508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University