View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7751_low_11 (Length: 234)
Name: NF7751_low_11
Description: NF7751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7751_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 87 - 216
Target Start/End: Original strand, 8481711 - 8481840
Alignment:
| Q |
87 |
gagattaattaccgagaattggattatggaagagaattaaattgagaatgagaagaaagggtttgggtttgagagagaatttaaaggcaaacccaaacgc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8481711 |
gagattaattaccgagaattggattatggaagagaattaaattgagaatgagaagaaagggtttgggtttgagagagaatttaaaggcaaacccaaacgc |
8481810 |
T |
|
| Q |
187 |
gaaatggtgcaaaaaagaaactgtattgcg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8481811 |
gaaatggtgcaaaaaagaaactgtattgcg |
8481840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University