View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7751_low_4 (Length: 439)
Name: NF7751_low_4
Description: NF7751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7751_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 421; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 421; E-Value: 0
Query Start/End: Original strand, 1 - 425
Target Start/End: Complemental strand, 30138542 - 30138118
Alignment:
| Q |
1 |
tgcatgggcttcaggtttaaccttagccattccaatcctcactttcatctctttccaccttaacagccaataccaaaccctaatcacagcagcatccaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138542 |
tgcatgggcttcaggtttaaccttagccattccaatcctcactttcatctctttccaccttaacagccaataccaaaccctaatcacagcagcatccaca |
30138443 |
T |
|
| Q |
101 |
ggcattggagttttcttctgtcttccagcaggattcttcaaaacaaccttaatcttcattccctacattgctttcatagtcttagctagcacagttgcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138442 |
ggcattggagttttcttctgtcttccagcaggattcttcaaaacaaccttaatcttcattccctacattgctttcatagtcttagctagcacagttgcaa |
30138343 |
T |
|
| Q |
201 |
gttcatctcacactcaccatcttgctctcatgatttcttccttcaacaaatccaaaacaaacaaagtttcaagtttcttctctctttatgctacttcttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138342 |
gttcatctcacactcaccatcttgctctcatgatttcttccttcaacaaatccaaaacaaacaaagtttcaagtttcttctctctttatgctacttcttt |
30138243 |
T |
|
| Q |
301 |
tggttgtttaggttcagccattatctcttctttcatttaccatatgcttcgagaacccgatgatcgtaattatttcaccctttggattgtttcaatcttc |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138242 |
tggttgtttaggttcagccattatctcttctttcatttaccatatgcttcgagaacctgatgatcgtaattatttcaccctttggattgtttcaatcttc |
30138143 |
T |
|
| Q |
401 |
agtggcttaatttggttagttggtg |
425 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30138142 |
agtggcttaatttggttagttggtg |
30138118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University