View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7752_low_6 (Length: 420)
Name: NF7752_low_6
Description: NF7752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7752_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 133 - 404
Target Start/End: Original strand, 39104805 - 39105076
Alignment:
| Q |
133 |
gcaactgaattttcacagatcatagttctctattagattctctcattccgtttttcccgcactttcctacctcgattttctcccccgccgcactttccgg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39104805 |
gcaactgaattttcacagatcatagttctctattagattctctcattccgtttttcccgcactttcctacctcgattttctcccccgccgcactttccgg |
39104904 |
T |
|
| Q |
233 |
acttctccgacctctcaaccaccagaatccgttcattctccgatcgcttcattcatccgctacctaccacctcccaccgccgttaatcggcgccggaagt |
332 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39104905 |
acttctccgacctctcaaccaccggaatccgttcattctccgatcgcttcattcatccgctacctaccacctcccaccgccgttaatcggcgccggaagt |
39105004 |
T |
|
| Q |
333 |
tgaagtaacattcgtgtttacacgctagagtcgttgtttcagtgttgcgtgaagttcggaggcagtgttatg |
404 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39105005 |
tgaagtaacagtcgtgtttacacgctagagtcgttgtttcagtgttgcgtgaagttcggaagcagtgttatg |
39105076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University