View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7753_high_11 (Length: 359)
Name: NF7753_high_11
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7753_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 4 - 309
Target Start/End: Original strand, 26961937 - 26962244
Alignment:
| Q |
4 |
tcttcaagttttgcaactgattttgctaatgcaatggtcaaaatggggaaccttaatcctatcactgggtctaatggtcagattaggaccaactgcaggg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26961937 |
tcttcaagttttgcaactgattttgctaatgcaatggtcaaaatggggaatcttaatccaattactgggtctaatggtcagattaggaccaactgcaggg |
26962036 |
T |
 |
| Q |
104 |
taatcaattgagttttggggcctattgggaacata--atgcaagttgattatgggtatttttcatttttaaggtgtgcaattgtgtaatattattgtggc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26962037 |
taatcaattgagttttggggcctattgggaacatataatgcaagttgattatgggtatttttcatttttaaggtgtgcaattgtgtaatattattgtggc |
26962136 |
T |
 |
| Q |
202 |
aaagtcaaagtttccataaatgtaaggtgtgtttgaattttaaatggatttatttcaatgtttgtaactgtttaattatgatcttgtttgcaactggcag |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26962137 |
aaagtcaaagtttccataaatgtaaggtgtgtttgaattttaaatggatttatgtcaatgtttgcaactgtttaattatgatcttgtttgcaactggcag |
26962236 |
T |
 |
| Q |
302 |
agtcaaat |
309 |
Q |
| |
|
|||||||| |
|
|
| T |
26962237 |
agtcaaat |
26962244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University