View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7753_high_31 (Length: 243)
Name: NF7753_high_31
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7753_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 54451701 - 54451918
Alignment:
| Q |
19 |
atataagtttcttcttacggaggaatttaccattacatatcagttctcacatcatattttaatttcatccatgatatattttgacaagaggctattcatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54451701 |
atataagtttcttcttacggaggaatttaccattacatatcagttctcacatcatattttaatttcatccatgatatattttgacaagaggctattcatt |
54451800 |
T |
 |
| Q |
119 |
ttgggtaatttctcggtaaccttgttactatttttatgagttaagagcaagttcttgaaaatgggaaaagaaacatggtctattttcttcaaggttgtac |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54451801 |
ttgggtaatttcttggtaaccttgttactatttttatgagttaagagcaagttcttgaaaatgggaaaagaaacatcgtctattttcttcaaggttgtac |
54451900 |
T |
 |
| Q |
219 |
tgacttgtttttatgtgt |
236 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
54451901 |
taacttgtttttatgtgt |
54451918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University