View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7753_high_34 (Length: 238)
Name: NF7753_high_34
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7753_high_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 10 - 215
Target Start/End: Complemental strand, 45681296 - 45681091
Alignment:
| Q |
10 |
tatcttggatctcaaaggtacaagtttgattagcgatttgggaccttgtgaacaagaagatttttagaagtagagatgttatattttttaggatcaggca |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45681296 |
tatcttggatctcaaagatacaagtttgattagcgatttgggaccttgtgaacaagaagatttttagaagtagagatgttatattttttaggatcaggca |
45681197 |
T |
|
| Q |
110 |
gctaaatattccaaacagtatgagaaaacttagtcaaaggtcaaacagtagttgtaatcagaagtcgtcccctatggtacgccatgatgatttagggggg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45681196 |
gctaaatattccaaacagtatgagaaaacttagtcaaaggtcaaacagtagttgtaatcagaagtcgtcccctatggtacgccatgatgatttagggggg |
45681097 |
T |
|
| Q |
210 |
ctatct |
215 |
Q |
| |
|
|||||| |
|
|
| T |
45681096 |
ctatct |
45681091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University