View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7753_high_41 (Length: 212)

Name: NF7753_high_41
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7753_high_41
NF7753_high_41
[»] chr1 (1 HSPs)
chr1 (17-201)||(51367294-51367478)


Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 51367478 - 51367294
Alignment:
17 aaaactaaaactaagtccagattaatggacccacccgatgaaccggatagaagatctggtcgggttgctaaatcgagtcagcttttgtccgggatgattg 116  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51367478 aaaactaaaactaagtccagattaatggacccacccgatgaacctgatagaagatctggtcgggttgctaaatcgagtcagcttttgtccgggatgattg 51367379  T
117 ggaggaaaggtgatgatgatgaagatgatccttttatggaagaggattttccagatgagtataagaaaacacattttagtctctg 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51367378 ggaggaaaggtgatgatgatgaagatgatccttttatggaagaggattttccagatgagtataagaaaacacattttagtctctg 51367294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University