View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7753_high_44 (Length: 201)
Name: NF7753_high_44
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7753_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 12 - 183
Target Start/End: Original strand, 29940618 - 29940789
Alignment:
| Q |
12 |
gaagaatataatttggtcaggaaaaggatacattgtgtgaacataatgcaaaaattgatatgcagtagtactagttgttattaacacggctagaacaact |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29940618 |
gaagaaaataatttggtcaggaaaaggatacattgtgtgaacataaaacaaaaattgatatgcagtagtactagttgttattaacacggctagaacaact |
29940717 |
T |
 |
| Q |
112 |
taaattctatgtatatatagaaggttttagtccaaagtatattaatgttaaactgaatatgagagcatatat |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29940718 |
taaattctatgtatatatagaaggttttagtccaaagtatattaatgtcaaactgaatatgagagcatatat |
29940789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University