View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7753_high_9 (Length: 366)
Name: NF7753_high_9
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7753_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 9e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 179 - 348
Target Start/End: Complemental strand, 7177115 - 7176946
Alignment:
| Q |
179 |
gtcagcaacatctccatcatcctaggacaacaaccttacattggtttagcaacaaatgcatgtccacgaaaaggcgattcaaaatcaatccgaggttaca |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7177115 |
gtcagcaacatctccatcatcctaggacaacaaccttatattggtttagcaacaaatgcatgtccacgaaaaggcgattcaaaatcaatccgaggttaca |
7177016 |
T |
|
| Q |
279 |
catgtaacggcaaaactcaaacatgccaagcatacctcaccttcagaactcaaccaatttactcctcagt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7177015 |
catgtaacggcaaaactcaaacatgccaagcatacctcaccttcagaactcaaccaatttactcctcagt |
7176946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 20 - 129
Target Start/End: Complemental strand, 7177277 - 7177168
Alignment:
| Q |
20 |
aaaagagtcctatcgtaaaataattggatttatgctcctagtatgtaacaaaagactcgatttatatattgcattattacaccccattctctgcaagcaa |
119 |
Q |
| |
|
||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7177277 |
aaaagagtcatatcataaaataattggctttatgctcctagtatgtaacaaaagactcgatttatatattgcattattacaccccattctctgcaagcaa |
7177178 |
T |
|
| Q |
120 |
taacaatgca |
129 |
Q |
| |
|
|||||||||| |
|
|
| T |
7177177 |
taacaatgca |
7177168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University