View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7753_low_23 (Length: 309)
Name: NF7753_low_23
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7753_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 113 - 272
Target Start/End: Complemental strand, 5923291 - 5923132
Alignment:
| Q |
113 |
gtgttcttagatgggaaaaatgaacacttttcgtttaatcccgtttttagttannnnnnnaaataattttggttaatgtacaaaagaagagtcattagag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5923291 |
gtgttcttagatgggaaaaatgaacacttttcgtttaatcccgtttttagttattttttttaataattttggttaatgtacaaaagaagagtcattagag |
5923192 |
T |
 |
| Q |
213 |
aaagtgttgttgggattagtgaatgatattcatttccaagaagttgagggaacgaaaggg |
272 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5923191 |
aaagtgttgttgggattagtgaatgaaattcatttccaagaagttgagggaacgaaaggg |
5923132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 5923403 - 5923350
Alignment:
| Q |
1 |
tttggtgaagcgaattgggattagcagaatcgattcgtaaatgtaattattgga |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5923403 |
tttggtgaagcgaattgggattagcagaatcgattcgtaaatgtaattattgga |
5923350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University