View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7753_low_33 (Length: 254)
Name: NF7753_low_33
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7753_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 118 - 232
Target Start/End: Original strand, 21945417 - 21945531
Alignment:
| Q |
118 |
acattatatatagatccatgtgatcatatgtggctattaaaatattccatcgtttttcattttgaaaataaaatatatgttgatttagattccaaatctg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21945417 |
acattatatatagatccatgtgatcatatgtggctattaaaatattccatcgtttttcattttgaaaataaaatatatgttgatttagattgcaaatctg |
21945516 |
T |
 |
| Q |
218 |
gcgtaaagtcatccc |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21945517 |
gcgtaaagtcatccc |
21945531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 19 - 129
Target Start/End: Original strand, 21945131 - 21945236
Alignment:
| Q |
19 |
ctagatccattcttgtttctgttatatctttcctttaaggtacttttaattgctttgatgcttgtgcatttaaatagagcgcaagacacacacattaata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21945131 |
ctagatccattcttgtttctgttatatctttcttttaaggtacttttaattgctt-----cttgtgcatttaaatagagcgcaagacacacacattaata |
21945225 |
T |
 |
| Q |
119 |
cattatatata |
129 |
Q |
| |
|
|||||||||| |
|
|
| T |
21945226 |
tattatatata |
21945236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University