View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7753_low_38 (Length: 243)

Name: NF7753_low_38
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7753_low_38
NF7753_low_38
[»] chr2 (1 HSPs)
chr2 (87-223)||(8481711-8481847)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 87 - 223
Target Start/End: Original strand, 8481711 - 8481847
Alignment:
87 gagattaattaccgagaattggattatggaagagaattaaattgagaatgagaagaaagggtttgggtttgagagagaatttaaaggcaaacccaaacgc 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8481711 gagattaattaccgagaattggattatggaagagaattaaattgagaatgagaagaaagggtttgggtttgagagagaatttaaaggcaaacccaaacgc 8481810  T
187 gaaatggtgcaaaaaagaaactgtattgcgttggcag 223  Q
    |||||||||||||||||||||||||||||||||||||    
8481811 gaaatggtgcaaaaaagaaactgtattgcgttggcag 8481847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University