View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7753_low_38 (Length: 243)
Name: NF7753_low_38
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7753_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 87 - 223
Target Start/End: Original strand, 8481711 - 8481847
Alignment:
| Q |
87 |
gagattaattaccgagaattggattatggaagagaattaaattgagaatgagaagaaagggtttgggtttgagagagaatttaaaggcaaacccaaacgc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8481711 |
gagattaattaccgagaattggattatggaagagaattaaattgagaatgagaagaaagggtttgggtttgagagagaatttaaaggcaaacccaaacgc |
8481810 |
T |
 |
| Q |
187 |
gaaatggtgcaaaaaagaaactgtattgcgttggcag |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8481811 |
gaaatggtgcaaaaaagaaactgtattgcgttggcag |
8481847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University