View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7753_low_4 (Length: 497)
Name: NF7753_low_4
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7753_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 16 - 308
Target Start/End: Complemental strand, 2608298 - 2608006
Alignment:
| Q |
16 |
agattgttgtgtgggaagagaaattgggagggtgttaagtgtgtaagtgatgatgatgttatttgtttgtatagagaacttggatatggaatggtgattt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2608298 |
agattgttgtgtgggaagagaaattgggagggtgttaagtgtgtaagtgatgatgatgtaatttgtttgtatagagaacttggatatggaatggtgattt |
2608199 |
T |
|
| Q |
116 |
gtagaaaagttgggaatatgggtcgatgggaatggctttgggttgatgggtgtgattacatcaaagggaaaaaagtgcttaattgtcctataagaggaat |
215 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2608198 |
gtagaaaagttgcgaatatgggtcgatgggaatggctttgggttgatgggtgtgattacatcaaagggaaaaaagtgcttaattgtcctataagaggaat |
2608099 |
T |
|
| Q |
216 |
acttgttcatccaactcttgcttcttcatctattttcttttaaatttgaaatcatctttgggtgtgttttttagaggttttattcgtgtatga |
308 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||| || ||| ||||||||||| |||||||||||| |||||||| |
|
|
| T |
2608098 |
acttgttcatccaactcttgcttcatcatctattttcttttaaattagaaatgatatttaggtgtgtttttgagaggttttatttgtgtatga |
2608006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University