View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7753_low_46 (Length: 218)
Name: NF7753_low_46
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7753_low_46 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 18271227 - 18271426
Alignment:
| Q |
1 |
tcctgaaaagctgagaagttatggagaaaatgcggaaaatgagcttaatatctgaagaaggaaaatgaattcaagcgtcggagacatggacttcaacttt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18271227 |
tcctgtaaagctgagaagttatggagaaaatgcggaaaatgagcttaatatctgaagaaggaaaatgaattcaagcgtcggagacatggacttcaacttt |
18271326 |
T |
 |
| Q |
101 |
tgcactgtcagaactagtgcacgtttctgcagaaaggttatagggccatgcagaattttgtattacagtcaagcacatgaagacctttgcacgaccgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18271327 |
tgcactgtcagaactagtgcacgtttctgcagaaaggttatagggccatgcagaattttgcattacagtcaagcacatgaagacctttgcacgaccgttt |
18271426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 23 - 156
Target Start/End: Original strand, 18279109 - 18279241
Alignment:
| Q |
23 |
ggagaaaatgcggaaaatgagcttaatatctgaagaaggaaaatgaattcaagcgtcggagacatggacttcaacttttgcactgtcagaactagtgcac |
122 |
Q |
| |
|
|||||||||| ||||| | |||||||| || || ||||||||||||||||||| || ||||| ||||||||| |||||||||||||||||||||| || |
|
|
| T |
18279109 |
ggagaaaatgtggaaatt-agcttaatgtccgatgaaggaaaatgaattcaagtgttggagatgtggacttcagattttgcactgtcagaactagtgtac |
18279207 |
T |
 |
| Q |
123 |
gtttctgcagaaaggttatagggccatgcagaat |
156 |
Q |
| |
|
|| | | ||| |||| |||||||||||||||| |
|
|
| T |
18279208 |
gtccccgtggaagggttgtagggccatgcagaat |
18279241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University