View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7753_low_49 (Length: 207)
Name: NF7753_low_49
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7753_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 77 - 183
Target Start/End: Original strand, 6326417 - 6326523
Alignment:
| Q |
77 |
gtagtaatgatcttcaaatcgtagtaaagatttaggaagcagcaccaatctttccatcttatgtgcaatcttattcataagtcttcgtgatccaaaattg |
176 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6326417 |
gtagtaataaacttcaaatcgtagtaaagatttaggaagcagcagcaatctttccatcttatgtgcaatcttattcataagtcttcgtgatccaaaattg |
6326516 |
T |
 |
| Q |
177 |
tatattc |
183 |
Q |
| |
|
||||||| |
|
|
| T |
6326517 |
tatattc |
6326523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 44
Target Start/End: Original strand, 6326375 - 6326414
Alignment:
| Q |
5 |
cttcttattggtctttaggtagcatcaatacttcaccaaa |
44 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6326375 |
cttcttattggtttttaggtagcatcaatacttcaccaaa |
6326414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University