View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7753_low_49 (Length: 207)

Name: NF7753_low_49
Description: NF7753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7753_low_49
NF7753_low_49
[»] chr1 (2 HSPs)
chr1 (77-183)||(6326417-6326523)
chr1 (5-44)||(6326375-6326414)


Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 77 - 183
Target Start/End: Original strand, 6326417 - 6326523
Alignment:
77 gtagtaatgatcttcaaatcgtagtaaagatttaggaagcagcaccaatctttccatcttatgtgcaatcttattcataagtcttcgtgatccaaaattg 176  Q
    |||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6326417 gtagtaataaacttcaaatcgtagtaaagatttaggaagcagcagcaatctttccatcttatgtgcaatcttattcataagtcttcgtgatccaaaattg 6326516  T
177 tatattc 183  Q
    |||||||    
6326517 tatattc 6326523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 44
Target Start/End: Original strand, 6326375 - 6326414
Alignment:
5 cttcttattggtctttaggtagcatcaatacttcaccaaa 44  Q
    |||||||||||| |||||||||||||||||||||||||||    
6326375 cttcttattggtttttaggtagcatcaatacttcaccaaa 6326414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University