View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7755_low_10 (Length: 441)
Name: NF7755_low_10
Description: NF7755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7755_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 7e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 42 - 175
Target Start/End: Original strand, 15148871 - 15149004
Alignment:
| Q |
42 |
tcaatgatcattgtctgtctcaaaatccgtctctaataaaatactttgttgtttagagaccaaatctagagatagaaacctagttgttcgactcaaattt |
141 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||| | ||||||||||||||||||| | |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15148871 |
tcaatgatcattgtttgtctctaaatccgtctctaatgagatactttgttgtttagagatcgaatctagagatagaaacctaattgttcgactcaaattt |
15148970 |
T |
|
| Q |
142 |
tgtctctgtaaacatccgtctctaaatccatctc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
15148971 |
tgtctctgtaaacatccgtctctaaatccatctc |
15149004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 208 - 272
Target Start/End: Original strand, 15150422 - 15150486
Alignment:
| Q |
208 |
tagggaagaaagaatcaccttgnnnnnnngaatcatgagagtgaaagaaacaattttgtatgatt |
272 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15150422 |
tagggaagaaagaatcaccttgaaaaaaagaatcatgagagtgaaagaaacaattttgtatgatt |
15150486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University