View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7755_low_15 (Length: 359)
Name: NF7755_low_15
Description: NF7755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7755_low_15 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
| [»] scaffold0150 (2 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 12 - 137
Target Start/End: Complemental strand, 18233773 - 18233648
Alignment:
| Q |
12 |
gagatgaagggagttccaatcgaagaaatgtcaaccgtatgggagaagcatccttattggagtgattttgttcaagcgaaacccaaacccaatgatcaag |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18233773 |
gagacgaagggagttccaatcgaagaaatgtcaaccgtatgggagaaacatccttattggagtgattttgttaaagcgaaacccaaacccaatgatcaag |
18233674 |
T |
|
| Q |
112 |
agttagggcagctttagattcttaag |
137 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
18233673 |
agttagggcagcgttagattcttaag |
18233648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 222 - 341
Target Start/End: Complemental strand, 18233585 - 18233469
Alignment:
| Q |
222 |
ggatagatttctagtttcaattattattattatgagttattaatagtaaaacctttcgcatattccagctctgccttttgagtatttctcaaccttttgt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18233585 |
ggatagatttctagtttcaattattattat---gagttattaatagtaaaacctttcgcatattccagctctgccttttgagtatttctcaaccttttgt |
18233489 |
T |
|
| Q |
322 |
taacaaaatcatgttattat |
341 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
18233488 |
taacaaaatcatgttattat |
18233469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 222 - 343
Target Start/End: Original strand, 131622 - 131740
Alignment:
| Q |
222 |
ggatagatttctagtttcaattattattattatgagttattaatagtaaaacctttcgcatattccagctctgccttttgagtatttctcaaccttttgt |
321 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
131622 |
ggataaatttctagtttcaatta---ttattatgagttattaatagtaaaacctttcgcatattccagctctgccttttgagtacttctcaaccttttgt |
131718 |
T |
|
| Q |
322 |
taacaaaatcatgttattatct |
343 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
131719 |
taacaaaatcatgttattatct |
131740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0150 (Bit Score: 52; Significance: 9e-21; HSPs: 2)
Name: scaffold0150
Description:
Target: scaffold0150; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 288 - 343
Target Start/End: Complemental strand, 1433 - 1378
Alignment:
| Q |
288 |
agctctgccttttgagtatttctcaaccttttgttaacaaaatcatgttattatct |
343 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1433 |
agctctgccttttgagtacttctcaaccttttgttaacaaaatcatgttattatct |
1378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0150; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 288 - 343
Target Start/End: Complemental strand, 16599 - 16544
Alignment:
| Q |
288 |
agctctgccttttgagtatttctcaaccttttgttaacaaaatcatgttattatct |
343 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16599 |
agctctgccttttgagtacttctcaaccttttgttaacaaaatcatgttattatct |
16544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 288 - 343
Target Start/End: Complemental strand, 30866186 - 30866131
Alignment:
| Q |
288 |
agctctgccttttgagtatttctcaaccttttgttaacaaaatcatgttattatct |
343 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30866186 |
agctctgccttttgagtacttctcaaccttttgttaacaaaatcatgttattatct |
30866131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University