View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7755_low_20 (Length: 324)
Name: NF7755_low_20
Description: NF7755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7755_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 13766659 - 13766383
Alignment:
| Q |
1 |
taccagtcaaaagttcttcttcacagacaaaaaacaccgt--ctccttgcttgagccctttttgaatgtctatttcttaggtaggagaacaattgaccag |
98 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
13766659 |
taccagtcaaaagttcttcctcatagacaaaaaacaccgtgtctccttgcttgagccctttttgaatatcgatttcttaggtaggagaacaattgaccag |
13766560 |
T |
 |
| Q |
99 |
gacagcaggctacctgtaaacacacacactata-tccacgaccccatctcccctcaaaacaataatctcatttacagccacaaccccatctacatgttgt |
197 |
Q |
| |
|
|| |||||||||| | |||||||||||||| || |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13766559 |
gatagcaggctacttataaacacacacactctagtccacgaccccatctcccatcaaaacaataatctcatttatagccacaaccccatctacatgttgt |
13766460 |
T |
 |
| Q |
198 |
ctccctctaacgaaggccgattggttggcgaaaataattttctccatgatatgagctaaacgcaaagcaaggacctt |
274 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13766459 |
ctccctctaacgaaggtcgattggtttacgaaaataatcttctccatgatatgagctaaacgcaaagcaaggacctt |
13766383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 274 - 306
Target Start/End: Complemental strand, 13766347 - 13766315
Alignment:
| Q |
274 |
tcaggctaaaatcccctaaaagtatgggatatt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13766347 |
tcaggctaaaatcccctaaaagtatgggatatt |
13766315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University