View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7755_low_26 (Length: 265)
Name: NF7755_low_26
Description: NF7755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7755_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 36820808 - 36820567
Alignment:
| Q |
1 |
ataaggaaagcgatgcggtcgtcgttttgagaagagattttgaaatcgtcgaagaggagttggttggtgaattgtgcgatggattggattccgtcgccgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36820808 |
ataaggaaagcgatgcggtcgtcgttttgagaagagattttgaaatcgtcgaagaggagttggttggtgaattgtgcgatggattggattccgtcgccgt |
36820709 |
T |
|
| Q |
101 |
tgaggaggttgtggaggaagagtgtgtgggtttttgtgaagtagagatggcaggtttttgaggttttttctagggatgggatgaaacgtttctcaagtag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36820708 |
tgaggaggttgtggaggaagagtgtgtgggtttttgtgaagtagagatggcaggtttttgcggttttttctagggatgggatgaaacgtttctcaagtag |
36820609 |
T |
|
| Q |
201 |
gtttacgccggtttctgtcatgaacgctttgaacttcattgt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36820608 |
gtttacgccggtttctgtcatgaacgctttgaacttcattgt |
36820567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University