View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7757_low_3 (Length: 378)
Name: NF7757_low_3
Description: NF7757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7757_low_3 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 7 - 378
Target Start/End: Complemental strand, 32664967 - 32664597
Alignment:
| Q |
7 |
tttggtggtttagtatacacgccgacttgagtccctcgattttttctccatacaccaaagtctatgtactttgtggtgtcttgtcctctttctttctctc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32664967 |
tttggtggtttagtatacacgccgacttgagtccctcgattttttctccatacaccaaaggctttgtactt-gtggtgtcttgtcctctttctttctctc |
32664869 |
T |
 |
| Q |
107 |
ggggttagatctgaaccactttgtattcgacaatcctattttattccacagtcaaccatcggttatggcaaaaggcttcaacggaacacgaattgttctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32664868 |
ggggttagatctgaaccactttgtattcgacaatcctattttattccacagtcaaccatcggttatggcaaaaggcttcaacggaacacgaattgttctt |
32664769 |
T |
 |
| Q |
207 |
agtattttattgttatgtttcacctctcttattaatatccctcaaaccaacgccatttggttaagtatccctagttcaggaactaagtgcgtgtcgcagg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32664768 |
agtattttattgttatgtttcacctctcttattaatatccctcaaaccaacgccatttggttaagtatccctagttcaggaactaagtgcgtgtcgcagg |
32664669 |
T |
 |
| Q |
307 |
atatccaaacacacgttgttgttttagccaattactatgttgttgccgataatatccagggtcatccacttc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32664668 |
atatccaaacacacgttgttgttttagccaattactatgttgttgccgataatatccagggtcatccacttc |
32664597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 352
Target Start/End: Complemental strand, 24026061 - 24025988
Alignment:
| Q |
279 |
agttcaggaactaagtgcgtgtcgcaggatatccaaacacacgttgttgttttagccaattactatgttgttgc |
352 |
Q |
| |
|
|||||||| ||||| || ||||| ||||||| |||||||| || ||||||||||| |||||||||||||||| |
|
|
| T |
24026061 |
agttcaggtactaaatgtgtgtctgaggatattcaaacacatgtcgttgttttagctgattactatgttgttgc |
24025988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University