View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7758_low_8 (Length: 306)
Name: NF7758_low_8
Description: NF7758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7758_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 17 - 289
Target Start/End: Complemental strand, 486247 - 485975
Alignment:
| Q |
17 |
gtaaagaagcacggaaagacccttctactattggaagtaatagaacatagggtcgaccagagtttggatctgaacccggatttggatccgagttctggag |
116 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
486247 |
gtaaagaagctcggaaagacccttctattattggaagtaatagaacatagggtcgaccagagtttggatctgaacccggatttggatccgagttctggag |
486148 |
T |
|
| Q |
117 |
catgaggaattgggtctcagtttctaggtctttgccatttgaaccggtccaaagagtggtccaccacactttgaatcggaaaatgctagtaaagtttatg |
216 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
486147 |
catgaggaattgggtctcggtttctaagtctttgccatttgaaccggtccaaagagtggtccaccacactttaaatcggaaaatgctagtaaagtttatg |
486048 |
T |
|
| Q |
217 |
tttttgagttttccaatgtgtgcaacatggcggcttttcacttcattggcttcaaaaccaaggaagcaaccgt |
289 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
486047 |
tttttgagctttccaatgtgtgcaacatggcggcttttcgcttcgttggcttcaaaaccaaggaagcaaccgt |
485975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University