View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7759_high_2 (Length: 400)
Name: NF7759_high_2
Description: NF7759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7759_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 9e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 16 - 203
Target Start/End: Complemental strand, 7296747 - 7296557
Alignment:
| Q |
16 |
attcttcaatcaaccgcaagcatgcctgattcaggcggcggaaccgtacttacgtagtcacactttttgtcctttctgtttgttctttcttcattgcttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7296747 |
attcttcaatcaaccgcaagcatgcctgattcaggcggcggaaccgtacttacgtagtcacactttttgtcctttctgtttgttctttcttcattgcttt |
7296648 |
T |
|
| Q |
116 |
gcttaggtatgt-aagtacattg--aatcacacgtgttttctttcctctttcaaatctttctttttatcaaaatccatcgcaaatagggac |
203 |
Q |
| |
|
||||||||| || |||||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
7296647 |
gcttaggtaggtaaagtacattggaaatcacacatgttttctttcctctttcaaatctttttttttatcaaaatccatcacaaatagggac |
7296557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 81
Target Start/End: Original strand, 7347447 - 7347487
Alignment:
| Q |
41 |
ctgattcaggcggcggaaccgtacttacgtagtcacacttt |
81 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7347447 |
ctgattcaggcggcggaaccgtactcacgtagtcacacttt |
7347487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University