View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7760_high_9 (Length: 257)
Name: NF7760_high_9
Description: NF7760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7760_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 39504702 - 39504939
Alignment:
| Q |
1 |
tgtagaaaagaatgcttgctcagcctcttgttactccagtagttttttattcgaattcaactactttttcttacttcctaggttgaaatttcttgcagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
39504702 |
tgtagaaaagaatgcttgctcagcctcttgttactccagtagttttttattcgaattcaactactttttcttacttcctaggttaaaatttcatgcagaa |
39504801 |
T |
|
| Q |
101 |
tctgatgatggtggtaagttccttgtttacaatagatggggaagggtaggcataaagggccaagacaagatacacggcccttactcttcacgtgaaagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
39504802 |
tctgatgatggtggtaagttccttgtttacaatagatggggaagggtaggcataaagggccaagacaagatacacggcccttacccttcgcgtgaaagtg |
39504901 |
T |
|
| Q |
201 |
caatccaggagtttgaacaaaagttctttgccaagacc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39504902 |
caatccaggagtttgaacaaaagttctttgccaagacc |
39504939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 132 - 238
Target Start/End: Complemental strand, 27955252 - 27955146
Alignment:
| Q |
132 |
atagatggggaagggtaggcataaagggccaagacaagatacacggcccttactcttcacgtgaaagtgcaatccaggagtttgaacaaaagttctttgc |
231 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
27955252 |
atagatggggaatggtaggcataaagggccaagacaaggtacacgacccttactcttcacgtgaaagcgcaatccaggagtttgaacaaaagttcttagc |
27955153 |
T |
|
| Q |
232 |
caagacc |
238 |
Q |
| |
|
||||||| |
|
|
| T |
27955152 |
caagacc |
27955146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University