View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7760_low_11 (Length: 250)
Name: NF7760_low_11
Description: NF7760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7760_low_11 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 25847138 - 25847374
Alignment:
| Q |
13 |
aatatggcggcaactcgaaagtttatttatgttttgagtctctttctttccatattgtttgtcaccaaaataactgatggtaagttatcaattttcaccc |
112 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25847138 |
aatatggcggcaacacgaaagtttatttatgttttgagtctctttctttccatatttttt-tcaccaaaataactgatggtaagttatcaattttcaccc |
25847236 |
T |
 |
| Q |
113 |
ttctcaaatttaattcattatttcattgtttgtaaccaaaattttatcatgtttcaataacaatgttccattctcttttttctttgtagcttgtaaaaca |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25847237 |
ttctcaaatttcattcattatttcattgtttgtaaccaaaattttatcatgtttcaataacaatgttccattctcttttttctttgtagcttgtaaaaca |
25847336 |
T |
 |
| Q |
213 |
gacaaagattgtccagaatcaaaatacagatatatatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25847337 |
gacaaagattgtccagaatcaaaatacagatatatatt |
25847374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 14 - 128
Target Start/End: Original strand, 25832907 - 25833021
Alignment:
| Q |
14 |
atatggcggcaactcgaaagtttatttatgttttgagtctctttctttccatattgtttgtcaccaaaataactgatggtaagttatcaattttcaccct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| | |||| ||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
25832907 |
atatggcggcaactcgaaagtttatttatgttttgagtcactttcttttcttatttcttgtcaccaaaataactgacggtaagttatcaattttcaacct |
25833006 |
T |
 |
| Q |
114 |
tctcaaatttaattc |
128 |
Q |
| |
|
||||| |||| |||| |
|
|
| T |
25833007 |
tctcagatttcattc |
25833021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University