View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7760_low_14 (Length: 230)
Name: NF7760_low_14
Description: NF7760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7760_low_14 |
 |  |
|
| [»] scaffold1395 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 43334505 - 43334309
Alignment:
| Q |
17 |
tattgcaaggttaacgatgaacgagtgcagtcaagtgaaggtgaaaatcttgaccttcctcaggtcattcagagtaatttgttaacaccaaatggaatcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43334505 |
tattgcaaggttaacgatgaacgagtacagtcaagtgaaggtgaaaatcttgaccttcctcaggtccttcagagtaatttgttaacaccaaatggaatcc |
43334406 |
T |
 |
| Q |
117 |
acagatcaaacattgatttgtcgaaggccatggaagctgttgccgaaacgtcaaacgtcactctgaaaaccaagttttcaacttactataaggctgt |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43334405 |
acagatcaaacattgatttgtctaaggccatggaagctgttgccgaaacgtcaaacgttactctgaaaaccaagttttcaacttactataaggctgt |
43334309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 43338940 - 43338744
Alignment:
| Q |
17 |
tattgcaaggttaacgatgaacgagtgcagtcaagtgaaggtgaaaatcttgaccttcctcaggtcattcagagtaatttgttaacaccaaatggaatcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43338940 |
tattgcaaggttaacgatgaacgagtacagtcaagtgaaggtgaaaatcttgaccttcctcaggtccttcagagtaatttgttaacaccaaatggaatcc |
43338841 |
T |
 |
| Q |
117 |
acagatcaaacattgatttgtcgaaggccatggaagctgttgccgaaacgtcaaacgtcactctgaaaaccaagttttcaacttactataaggctgt |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43338840 |
acagatcaaacattgatttgtctaaggccatggaagctgttgccgaaacgtcaaacgttactctgaaaaccaagttttcaacttactataaggctgt |
43338744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1395 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: scaffold1395
Description:
Target: scaffold1395; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 216
Target Start/End: Complemental strand, 309 - 110
Alignment:
| Q |
17 |
tattgcaaggttaacgatgaacgagtgcagtcaagtgaaggtgaaaatcttgaccttcctcaggtcattcagagtaatttgttaacaccaaatggaatcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
309 |
tattgcaaggttaacgatgaacgagtacagtcaagtgaaggtgaaaatcttgaccttcctcaggtccttcagagtaatttgttaacaccaaatggaatcc |
210 |
T |
 |
| Q |
117 |
acagatcaaacattgatttgtcgaaggccatggaagctgttgccgaaacgtcaaacgtcactctgaaaaccaagttttcaacttactataaggctgttat |
216 |
Q |
| |
|
||||||||||||||||||| || |||| |||||||| ||||||| ||||||||||||| ||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
209 |
acagatcaaacattgatttttctaaggtcatggaagttgttgcctaaacgtcaaacgttactcttaaaatcaagttttcaacttactataaggctgttat |
110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University