View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7761_high_21 (Length: 201)

Name: NF7761_high_21
Description: NF7761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7761_high_21
NF7761_high_21
[»] chr4 (1 HSPs)
chr4 (14-110)||(29939931-29940027)


Alignment Details
Target: chr4 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 14 - 110
Target Start/End: Original strand, 29939931 - 29940027
Alignment:
14 aagaaattaatcagaataannnnnnnattaaaatgagaagttgtaagtagttttggacagaaaataatccaattttaatgagtgttgtagataagag 110  Q
    |||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29939931 aagaaattaatcagaataatttttttattaaaatgagaagttgtaagtagttttggacagaaaataatccaattttaatgagtgttgtagataagag 29940027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University