View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7761_low_14 (Length: 389)
Name: NF7761_low_14
Description: NF7761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7761_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 17 - 378
Target Start/End: Original strand, 39956907 - 39957268
Alignment:
| Q |
17 |
atgaccagatcataatgaccccacatgttctttagaatgtgaaagcaaaatgctttgtgccctattgaaagcatgtcatatcaaataattcagggtatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39956907 |
atgaccagatcataatgaccccacatgttctttagaatgtgaaagcaaaatgctttgtgccctattgaaagcatgtcatatcaaataattcagggtatgt |
39957006 |
T |
|
| Q |
117 |
cttatcaacttagatccgggaagagttttttggagctgcgtatataatcacgggacatgttcttgaaactatactatgtgtcccttaataatcatgttct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39957007 |
cttatcaacttagatccgggaagagttttttggagttgcgtatataatcacgggacatgttcttgaaactatactatgtgtcccttaataatcatgttct |
39957106 |
T |
|
| Q |
217 |
agaaaagggtaggcatttgttgactggtaaattatgtttatcttataatagaatgtaccttagattagattttgcaactcataacactttatgcccaact |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39957107 |
agaaaagggtaggcatttgttgactggtaaattatgtttatcttataatagaatgtaccttagattagattttgcaactcataacactttatgcccaact |
39957206 |
T |
|
| Q |
317 |
gtttattacctgcttatctttgacttttgaggtcttagaattggacttgcctgtctgttctt |
378 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39957207 |
gtttattacctgtttatctttgactcttgaggtcttagaattggacttgcctgtctgttctt |
39957268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University