View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7761_low_16 (Length: 371)
Name: NF7761_low_16
Description: NF7761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7761_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 35 - 354
Target Start/End: Complemental strand, 14287416 - 14287077
Alignment:
| Q |
35 |
ctgataggattccagcactttcataattgcggctgcctcattaggatttgatctagcaaacaggaggttatcatctgcaaagaggagacgatctttggtg |
134 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14287416 |
ctgataggattccagcactttcatgattgcggctgcctcattaggatttgatctagcaaacaggagattatcatctgcaaagaggagacgatctttggtg |
14287317 |
T |
|
| Q |
135 |
cttttctttccatttgaataccatgtattttattgcgact--------------------cgtagctaacattagcacatttatttgatataacattgtg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14287316 |
cttttctttccatttgaataccatgtattttattgcgattgacttgatttttcatagacccgtagctaacattagcacatttatttgatataacattgtg |
14287217 |
T |
|
| Q |
215 |
aattatcctttataaatgtgttcaaatttcatattcatcaagtttaaaagttaaacagcttgatcaatacaaatgtgaaaatggaaaccaaatcaacttg |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14287216 |
aattatcctttataaatgtgttcaaatttcatattcatcgagttaaaaagttaaacagcttgatcaatacaaatgtgaaaatggaaaccaaatcaacttg |
14287117 |
T |
|
| Q |
315 |
gtaccaatttttgactttgcatgtcgcttataagtgttgc |
354 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14287116 |
gtaccaatttttgactttgcatgtcgctcataagtgttgc |
14287077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University