View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7761_low_19 (Length: 339)
Name: NF7761_low_19
Description: NF7761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7761_low_19 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
| [»] chr4 (5 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 3e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 251 - 339
Target Start/End: Original strand, 44121594 - 44121683
Alignment:
| Q |
251 |
gttcatagaatcaactttacaaacaaaatcaattgtcttttt-atcatccaaacacgataaaatcaattttgcaacatctagaatcattt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44121594 |
gttcatagaatcaactttacaaacaaaatcaattgtctttttgatcatccaaacacgataaaatcaattttgcaacatctagaattattt |
44121683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 166
Target Start/End: Original strand, 44121494 - 44121525
Alignment:
| Q |
135 |
ccgacaatgataaaattaagttgaatgtttat |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44121494 |
ccgacaatgataaaattaagttgaatgtttat |
44121525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 74; Significance: 6e-34; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 251 - 339
Target Start/End: Original strand, 50024254 - 50024343
Alignment:
| Q |
251 |
gttcatagaatcaactttacaaacaaaatcaattgtcttttt-atcatccaaacacgataaaatcaattttgcaacatctagaatcattt |
339 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50024254 |
gttcataaaatcaactttacaaacaaaatcaattgtctttttgatcatccaaacacgataaaatcaattttgcaacatctagaataattt |
50024343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 251 - 339
Target Start/End: Original strand, 50031372 - 50031461
Alignment:
| Q |
251 |
gttcatagaatcaactttacaaacaaaatcaattgtcttttt-atcatccaaacacgataaaatcaattttgcaacatctagaatcattt |
339 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50031372 |
gttcataaaatcaactttacaaacaaaatcaattgtctttttgatcatccaaacacgataaaatcaattttgcaacatctagaattattt |
50031461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 135 - 186
Target Start/End: Original strand, 50024138 - 50024189
Alignment:
| Q |
135 |
ccgacaatgataaaattaagttgaatgtttatgtttgaatatatttatatac |
186 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50024138 |
ccgacaataataaaattaagttgaatgtttatgtttgaatatatttatatac |
50024189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 135 - 186
Target Start/End: Original strand, 50031256 - 50031307
Alignment:
| Q |
135 |
ccgacaatgataaaattaagttgaatgtttatgtttgaatatatttatatac |
186 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50031256 |
ccgacaataataaaattaagttgaatgtttatgtttgaatatatttatatac |
50031307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 256 - 336
Target Start/End: Original strand, 29779131 - 29779212
Alignment:
| Q |
256 |
tagaatcaactttacaaacaaaatcaattgtcttttta-tcatccaaacacgataaaatcaattttgcaacatctagaatca |
336 |
Q |
| |
|
||||||||| | ||||| ||||||||||| |||||| | ||||||||||| ||||||||||||| | ||| |||||||||| |
|
|
| T |
29779131 |
tagaatcaattctacaagcaaaatcaattctcttttaaatcatccaaacatgataaaatcaattctacaatctctagaatca |
29779212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 256 - 336
Target Start/End: Complemental strand, 43987941 - 43987860
Alignment:
| Q |
256 |
tagaatcaactttacaaacaaaatcaattgtcttttta-tcatccaaacacgataaaatcaattttgcaacatctagaatca |
336 |
Q |
| |
|
||||||||| | | |||| |||||||||| |||||| | ||||||||||| ||||||||||||| | |||| |||||||||| |
|
|
| T |
43987941 |
tagaatcaattctgcaaagaaaatcaattatcttttaaatcatccaaacatgataaaatcaattctacaacttctagaatca |
43987860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University