View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7761_low_20 (Length: 320)
Name: NF7761_low_20
Description: NF7761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7761_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 92 - 301
Target Start/End: Original strand, 49436139 - 49436350
Alignment:
| Q |
92 |
cacaaattcgatcgtaaccgaaaggatgagaaacgacgagaagctccaccttcacaagcagaagcttctcgaaagagagaaagatgaagtaaaatttgga |
191 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49436139 |
cacaaattcgatcgtaacagaaaggatgagaaacgacgagaagctccaccttcacaagcagaagcttctcgaaagagagaaagatgaagtaaaatttgga |
49436238 |
T |
|
| Q |
192 |
aagagaatgatatggttagtcaga--agagagaggtggaagaagagtttatatagtgacaatggtgaagagggtgtgtttgtttggtgcgagggaaaatc |
289 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49436239 |
aagagaatgatatggttagttagaagagagagaggtggaagaagagtttatatagtgacaatggtgaagagggtgtgtttgtttggtgcgagggaaaatc |
49436338 |
T |
|
| Q |
290 |
aaaaccgtcttc |
301 |
Q |
| |
|
|||||||||||| |
|
|
| T |
49436339 |
aaaaccgtcttc |
49436350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 49436048 - 49436090
Alignment:
| Q |
1 |
acgaaattaataaagcgcgctaaaaaacgaatgcgattattca |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49436048 |
acgaaattaataaagcgcgctaaaaaacgaatgcgattattca |
49436090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University