View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7761_low_23 (Length: 304)
Name: NF7761_low_23
Description: NF7761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7761_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 43432633 - 43432345
Alignment:
| Q |
1 |
tatttagatagatgcaacattatgttgatatttgctattaattttagagtaagcaatttcatacttgagtactaatcattgattactgtaccattctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43432633 |
tatttagatagatgcaacattatgttgatatttgctattaattttagagtaagcaatttcatacttgagtactaatcattgattactgtaccattctttt |
43432534 |
T |
 |
| Q |
101 |
t-agctcaacgagggagacaaaattgaacacttttaggagaatagagtaattgaatcacaatgtcacatactcagcagatgacttcgagtccacaaagca |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43432533 |
ttagctcaacgagggagacaaaattgaacacttttaggagaacagagtaattgaatcacaatgtcacatactcagcagatgacttcgagtccacaaagca |
43432434 |
T |
 |
| Q |
200 |
gcaaattgccatcagtgatctgaaagtcaacagcacgtaagagtttatgtgaaaacacatgaacccagtctgttcatcctacccaaact |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43432433 |
gcaaattgccatcagtgatctgaaagtcaacagcacgtaagagttaatgtgaaaacacatgaacccagtctgttcatcctacccaaact |
43432345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University