View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7761_low_32 (Length: 218)
Name: NF7761_low_32
Description: NF7761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7761_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 19 - 209
Target Start/End: Complemental strand, 36567352 - 36567162
Alignment:
| Q |
19 |
gggggaccgggggagcgctcggagcaacaacgaacccgtgctccattgttagatgtatgggtcgcctctcttatatatccagcgctgagcaacgctcatt |
118 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36567352 |
gggggacagggggagcgctcggagcaacaacaaaccagtgctccattgttagatgtatgggtcgcctctcttatatatccagcgctgagcaacgctcatt |
36567253 |
T |
 |
| Q |
119 |
tgtagtagttgtgtgactcaaccactcacacttgagcccaacaattattatctcttcaaacgtaacataactttatgtttctgatgtccat |
209 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36567252 |
tgtagtagctgtgtgactcaaccactcacacttgagcccaacaattattatctcttcaaacgtaacataactttatgtttctgctgtccat |
36567162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University