View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7761_low_32 (Length: 218)

Name: NF7761_low_32
Description: NF7761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7761_low_32
NF7761_low_32
[»] chr8 (1 HSPs)
chr8 (19-209)||(36567162-36567352)


Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 19 - 209
Target Start/End: Complemental strand, 36567352 - 36567162
Alignment:
19 gggggaccgggggagcgctcggagcaacaacgaacccgtgctccattgttagatgtatgggtcgcctctcttatatatccagcgctgagcaacgctcatt 118  Q
    ||||||| ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36567352 gggggacagggggagcgctcggagcaacaacaaaccagtgctccattgttagatgtatgggtcgcctctcttatatatccagcgctgagcaacgctcatt 36567253  T
119 tgtagtagttgtgtgactcaaccactcacacttgagcccaacaattattatctcttcaaacgtaacataactttatgtttctgatgtccat 209  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
36567252 tgtagtagctgtgtgactcaaccactcacacttgagcccaacaattattatctcttcaaacgtaacataactttatgtttctgctgtccat 36567162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University