View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7762_low_4 (Length: 282)
Name: NF7762_low_4
Description: NF7762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7762_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 19 - 166
Target Start/End: Original strand, 4908507 - 4908654
Alignment:
| Q |
19 |
tctatgcctagaagatttgggatttgtattccacatattaaatgtgtgatatgtttattgattttgtcatgtgatcaagatcgattattgcacttaaact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4908507 |
tctatgcctagaagatttgggatttgtattccgcacattaaatgtgtgacatgtttattgattttgtcatgtgatcaagatcgattattggacttaaact |
4908606 |
T |
 |
| Q |
119 |
gcatgttatttttaaatacatttaattcacatatgaagatgtgaatgc |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4908607 |
gcatgttatttttaaatacatttaattcacatatgaagatgtgaatgc |
4908654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 221 - 268
Target Start/End: Original strand, 4908709 - 4908756
Alignment:
| Q |
221 |
gaatatcttgaaattgaccttgaattgtttgctttaaattttttgtat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4908709 |
gaatatcttgaaattgaccttgaattgtttgctttaaattttttgtat |
4908756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University