View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7762_low_5 (Length: 243)
Name: NF7762_low_5
Description: NF7762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7762_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 102 - 227
Target Start/End: Complemental strand, 33813718 - 33813593
Alignment:
| Q |
102 |
gacatgcagccaattaccagagtgatagttgaaattaggagaaagaggagggcacaaaagtgatggtgcagctaaagtttgatcaactccaagaaaaccc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33813718 |
gacatgcagccaattaccagagtgatagttgaaattaggagaaagagaagggcacaaaagtgatggtgcagctaaagtttgatcaactccaagaaaaccc |
33813619 |
T |
|
| Q |
202 |
atttgagaagaaactgaaaacaaacc |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
33813618 |
atttgagaagaaactgaaaacaaacc |
33813593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 57
Target Start/End: Complemental strand, 33813814 - 33813763
Alignment:
| Q |
6 |
aacaaataatcttttgtgattttagtatgaattggagtgctccatggatttt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33813814 |
aacaaataatcttttgtgattttagtatgaattggagtgctccatggatttt |
33813763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University