View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7763_high_16 (Length: 265)

Name: NF7763_high_16
Description: NF7763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7763_high_16
NF7763_high_16
[»] chr3 (1 HSPs)
chr3 (23-249)||(48829061-48829287)


Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 23 - 249
Target Start/End: Original strand, 48829061 - 48829287
Alignment:
23 gactttcaaatgtaacactgatgcatcgattttaaagagctggagagaacgtggttggaattgaaatgtgtatccgcaatgatcatgaatattttgttga 122  Q
    ||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48829061 gactttcaaatgtaatactgatgcattgtttttaaagagctggagagaacgtggttggaattgaaatgtgtatccgcaatgatcatgaatattttgttga 48829160  T
123 gcgaaatcacttaaacatgttcctctattgccggttcgcggagtggaggcttagagtttgcttcaagctataaattgggttgggagagcaggggtatata 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48829161 gcgaaatcacttaaacatgttcctctattgccggttcgcggagtggaggcttagagtttgcttcaagctataaattgggttgggagagcaggggtatata 48829260  T
223 cccgacgatatcattttatagcttgat 249  Q
    |||||||||||||||||||||||||||    
48829261 cccgacgatatcattttatagcttgat 48829287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University