View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7763_high_16 (Length: 265)
Name: NF7763_high_16
Description: NF7763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7763_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 23 - 249
Target Start/End: Original strand, 48829061 - 48829287
Alignment:
| Q |
23 |
gactttcaaatgtaacactgatgcatcgattttaaagagctggagagaacgtggttggaattgaaatgtgtatccgcaatgatcatgaatattttgttga |
122 |
Q |
| |
|
||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48829061 |
gactttcaaatgtaatactgatgcattgtttttaaagagctggagagaacgtggttggaattgaaatgtgtatccgcaatgatcatgaatattttgttga |
48829160 |
T |
 |
| Q |
123 |
gcgaaatcacttaaacatgttcctctattgccggttcgcggagtggaggcttagagtttgcttcaagctataaattgggttgggagagcaggggtatata |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48829161 |
gcgaaatcacttaaacatgttcctctattgccggttcgcggagtggaggcttagagtttgcttcaagctataaattgggttgggagagcaggggtatata |
48829260 |
T |
 |
| Q |
223 |
cccgacgatatcattttatagcttgat |
249 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
48829261 |
cccgacgatatcattttatagcttgat |
48829287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University