View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7763_high_18 (Length: 250)
Name: NF7763_high_18
Description: NF7763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7763_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 9 - 244
Target Start/End: Complemental strand, 25780018 - 25779783
Alignment:
| Q |
9 |
ggacatcatcgccatggaggttcagtcacgtaccgaccgcacttccctcctcgccaccgcacaccactgcgaacaaaaatttcacgatctaaacctccga |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25780018 |
ggacaccatcgccatggaggttcagtcacgtaccaaccgcacttccctcctcgccaccgcacaccactgcgaacaaaaatttcacgatctaaaccgccga |
25779919 |
T |
 |
| Q |
109 |
ttcaaagacgacgtcccgccgccacaacagaacggtgatgtctccgccgccacggctgaagattccgatcacgttccatggcttgataaactccgtaaac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25779918 |
ttcaaagacgacgtcccgccgccacaacagaacggcgatgtctccgccgtcacggctgaagattccgatcacgttccatggcttgataaactccgtaaac |
25779819 |
T |
 |
| Q |
209 |
aacgtgttgctgagctccgtcgtgatgtccatctca |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25779818 |
aacgtgttgctgagctccgtcgtgatgtccaactca |
25779783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University