View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7763_high_27 (Length: 221)
Name: NF7763_high_27
Description: NF7763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7763_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 249458 - 249574
Alignment:
| Q |
1 |
tttgtatgtttgggaaggattttgggttatttgcattgttcaaacaaatatagtttgatgtctttttaaaaggaatattcaccgcaggaactgatgagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
249458 |
tttgtatgtttgggaaggattttgggttatttgcattgttcaaacaaatatagtttgatgtctttttaaaaggaatattcaccgcaggaattgatgagtg |
249557 |
T |
 |
| Q |
101 |
agaatagaaattggtaa |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
249558 |
agaatagaaattggtaa |
249574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 11162288 - 11162172
Alignment:
| Q |
1 |
tttgtatgtttgggaaggattttgggttatttgcattgttcaaacaaatatagtttgatgtctttttaaaaggaatattcaccgcaggaactgatgagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
11162288 |
tttgtatgtttgggaaggattttgggttatttgcattgttcaaacaaatatagtttgatgtctttttaaaaggagtattcaccgcaggaattgatgagtg |
11162189 |
T |
 |
| Q |
101 |
agaatagaaattggtaa |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
11162188 |
agaatagaaattggtaa |
11162172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 11201019 - 11200904
Alignment:
| Q |
1 |
tttgtatgtttgggaaggattttgggttatttgcattgttcaaacaaatatagtttgatgtctttttaaaaggaatattcaccgcaggaactgatgagtg |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||||||||| |
|
|
| T |
11201019 |
tttgtatgtttgggaagtattttgggttatttgcattgttcaaacaaatatagtttgatgtctttttaaaa-gagtattcaccgcaggaattgatgagtg |
11200921 |
T |
 |
| Q |
101 |
agaatagaaattggtaa |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
11200920 |
agaatagaaattggtaa |
11200904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University