View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7763_low_27 (Length: 297)
Name: NF7763_low_27
Description: NF7763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7763_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 38512465 - 38512178
Alignment:
| Q |
1 |
tgtggaccaactaaatgacagctttgaaaaatatgagttatattgaccgattttgaaagtgtgaaatagttttacattgtcgtcaaatcatatctcttca |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38512465 |
tgtggacaaactaaatgacagctttgaaaaatatgagttatattgactgattttgaaagtgtgaaatagttttacattgtcgtcaaatcatatctcttca |
38512366 |
T |
 |
| Q |
101 |
ttgagccacaccgctattttaaatcctaaaatatcttcacaaacatttgcagagatatatctggatgacagcgtaaaactattttatctattgaactctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
38512365 |
ttgagccacaccgctattttaaatcctaaaatatcttcacaaacatttgcagagatatatctggatgacagtgtaaaactattttatccattgaactctt |
38512266 |
T |
 |
| Q |
201 |
cacgaaattaggtataaacacttatgaagctgccactttcaccattgcgcactactttatgtccatatgcacactacttgatgtccat |
288 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38512265 |
catgaaattaggtataaacacttatgaagctgccactttcaccattgcgcactactttatgtccatatgcacactactttatgtccat |
38512178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University