View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7763_low_31 (Length: 253)
Name: NF7763_low_31
Description: NF7763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7763_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 27293455 - 27293638
Alignment:
| Q |
18 |
acatcaccatgaacacgttggtaagttgaagtgtgacacaaggaaataagttgaggtggtgatgaggaaacaaggtggttggttacagaggtgactcttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27293455 |
acatcaccatgaacacgttggtaagttgaagtgtgacacaaggaaataagttgaggtggtgatgaggaaacaaggtggttggttacagaggtgactcttc |
27293554 |
T |
 |
| Q |
118 |
tgatcactgtttcaatgtctttgttatctgccattggatattggagatatgaggtataagctatagcacttgtttttcatcaaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27293555 |
tgatcactgtttcaatgtctttgttatctgccattggatattggagatatgaggtataagctatagcacttgtttttcatcaaa |
27293638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University