View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7763_low_39 (Length: 240)

Name: NF7763_low_39
Description: NF7763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7763_low_39
NF7763_low_39
[»] chr5 (2 HSPs)
chr5 (81-232)||(16178329-16178479)
chr5 (1-79)||(16178558-16178636)
[»] chr8 (2 HSPs)
chr8 (125-232)||(16718668-16718775)
chr8 (100-232)||(16732486-16732617)


Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 81 - 232
Target Start/End: Complemental strand, 16178479 - 16178329
Alignment:
81 tatgttaaccttttgtttccttacccttccttttttcctcttgcgcagaaatgtggctttcaacgaggaggaattttccactagcaagccaggaagcttc 180  Q
    |||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16178479 tatgttaaccttttgtgtccttacccttctttttttc-tcttgcgcagaaatgtggctttcaacgaggaggaattttccactagcaagccaggaagcttc 16178381  T
181 tggagcattagaagcctaccatgttaaactgaaagccaaactttttgatgat 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
16178380 tggagcattagaagcctaccatgttaaactgaaagccaaactttttgatgat 16178329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 16178636 - 16178558
Alignment:
1 acaattgtgtctttagttggtaagaagtgcccaagatggatctgagaagtatctttaaaagtttattagatactttttg 79  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||    
16178636 acaattgtgtctttagttggtaagaagtgctcaagatggatctgagaagtatctttaaaagttcattagatactttttg 16178558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 125 - 232
Target Start/End: Original strand, 16718668 - 16718775
Alignment:
125 gcagaaatgtggctttcaacgaggaggaattttccactagcaagccaggaagcttctggagcattagaagcctaccatgttaaactgaaagccaaacttt 224  Q
    |||||||||||||||||||| | ||| ||| | ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||    
16718668 gcagaaatgtggctttcaacaatgagaaatgtgccactggcaagccaggaagcctctggagcattagaagcctaccatgttaaactgaaagctaaacttt 16718767  T
225 ttgatgat 232  Q
    ||||||||    
16718768 ttgatgat 16718775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 100 - 232
Target Start/End: Original strand, 16732486 - 16732617
Alignment:
100 cttacccttccttttttcctcttgcgcagaaatgtggctttcaacgaggaggaattttccactagcaagccaggaagcttctggagcattagaagcctac 199  Q
    ||||||||||||||  || | ||| |||||||||||||||||||| | ||| ||| | ||| | || ||||||||||| |||||||||||||||||||||    
16732486 cttacccttcctttcctc-tgttgtgcagaaatgtggctttcaacaatgagaaatgtgccagtggccagccaggaagcctctggagcattagaagcctac 16732584  T
200 catgttaaactgaaagccaaactttttgatgat 232  Q
    |||||||||||||||||||||||||||||||||    
16732585 catgttaaactgaaagccaaactttttgatgat 16732617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University