View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7763_low_40 (Length: 239)
Name: NF7763_low_40
Description: NF7763
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7763_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 5196774 - 5196552
Alignment:
| Q |
1 |
gtggatcagtaggttctgttaaatggggaagagaagttcatggaattatatgccggaagggatttgatgcgaatgttttcattgccagtgctcttattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5196774 |
gtggatcagtaggttctgttaaatggggaagagaagttcatggatttatatgccggaagggatttgatgcgaatgttttcattgccagtgctcttattga |
5196675 |
T |
|
| Q |
101 |
catgtattccaagtgtgggagtttaaaggatgctcgaaatgtattcgacaagattcaatgtaagaacgttgcttcatggaatgcaatgattgattgcttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5196674 |
catgtattccaagtgtgggagtttaaaggatgctcgaaatgtattcgacaagattcaatgtaagaacgttgcttcatggaatgcaatgattgattgcttc |
5196575 |
T |
|
| Q |
201 |
gggaagtgtggcatggttgattc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5196574 |
gggaagtgtggcatggttgattc |
5196552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 119
Target Start/End: Complemental strand, 11374175 - 11374147
Alignment:
| Q |
91 |
ctcttattgacatgtattccaagtgtggg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11374175 |
ctcttattgacatgtattccaagtgtggg |
11374147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University