View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7764_low_12 (Length: 218)
Name: NF7764_low_12
Description: NF7764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7764_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 38073941 - 38073762
Alignment:
| Q |
15 |
aatatactagtcctaaaattgacaaactgttttgttttacaaaaaagaaaatacgaatatgattttcttatcttgatattattaatattaacaaacagtg |
114 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38073941 |
aatatactagtcctaaaattgacaagctgttttgttttacaaaaaagaaaataagaatatgattttcttatcttgatattattaa------caaacagtg |
38073848 |
T |
 |
| Q |
115 |
aggggatatgttccaatcatcatgttaagaatattattgagaaaaattaagaaatgagttatatgtatgtgccgtactgttttacgt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38073847 |
aggggatatgttccaatcatcatgttaagaatattattgagaaaaattaagaaatgag-tatatgtatgtgccgtactgttttacgt |
38073762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University